View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12670_high_7 (Length: 377)
Name: NF12670_high_7
Description: NF12670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12670_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 52989320 - 52988944
Alignment:
| Q |
1 |
gaataaggtctaggtttaagatttacttatcatggacgagttaaatactaacggcaagactgatttcatttacagctaggtcatgccctggagttggtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52989320 |
gaataaggtctaggtttaagatttacttttcatggacgagttaaatactaacggcaagactgatttcatttacagctaggtcatgccctggagttggtcc |
52989221 |
T |
 |
| Q |
101 |
atgcggaacttttgccagagggcaaggtaaaaatcatcacagaatttaaaaaggacggcccaacggccatgctgggagatggtttaaatgatgcacccgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52989220 |
atgcggaacttttgccagagggcaaggtaaaaatcatcacagaatttaaaaaggacggcccaacggccatgctgggagatggtttaaatgatgcacccgc |
52989121 |
T |
 |
| Q |
201 |
attagcttcagctgatattggaatctcgatgggcatttcaggttctgcacttgcaagtgaaaccggcaacataattcttatgtcgaacgaccttaggaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52989120 |
attagcttcagctgatattggaatctcgatgggcatttcaggttctgcacttgcaagtgaaaccggcgacataattcttatgtcgaacgaccttaggaag |
52989021 |
T |
 |
| Q |
301 |
ataccagaagccattaagcttgcaagaaaagcacgaaggaaagtgatagagaacattgtattgtcagtcatcactaa |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52989020 |
ataccagaagccattaagcttgcaagaaaagcacgaaggaaagtgatagagaacattgtattgtcagtcatcactaa |
52988944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University