View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12670_low_13 (Length: 308)
Name: NF12670_low_13
Description: NF12670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12670_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 55174550 - 55174277
Alignment:
| Q |
17 |
agaaggttgatccaggcgaaggctcgtttattctgaccacctctctcatcatattgtttgagccgtgtatgtttgcgccaaacaaacatgactcccactc |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55174550 |
agaaggttgatccaggtgaaggctcgtttattctgaccacctctctcatcatattgtttgagccgtgtatgtttgcgtcaaacaaacatgactcccactc |
55174451 |
T |
|
| Q |
117 |
acaatctcgccttcctttccatattattagttctcttaccagccattgccgcagcacatgatcatggtcgtgttgcaggcattaacaatgttacttatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55174450 |
acaatctcgccttcctttccatattattagttctcttaccagccattgtcgcagcacatgatcatggtcgtgttgcaggcattaacaatgttacttatga |
55174351 |
T |
|
| Q |
217 |
tggtaaatcactctttgtcaatggaagacgcgagctcctcttctccggttccatccattacactcgcagcaccc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55174350 |
tggtaaatcactctttgtcaatggaagacgcgagctcctcttctccggttccatccattacactcgcagcaccc |
55174277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University