View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12670_low_16 (Length: 269)
Name: NF12670_low_16
Description: NF12670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12670_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 20 - 176
Target Start/End: Complemental strand, 12268439 - 12268283
Alignment:
| Q |
20 |
attgtgatcgaaacccagaagcaaaaatggagtgctgttgattttgagctcgattgttataannnnnnnaaaaagaagatttttatagtgcatcatcttt |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
12268439 |
attgtgatcgaaccccagaagcaaaaatggagtgctattaattttgagctcgattgttataatttttttaaaaagaaattttttatagtgtgtcatcttt |
12268340 |
T |
|
| Q |
120 |
ttgctataatttgtttatcaaagaaattttnnnnnnncttaaatgaaaaattggttt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12268339 |
ttgctataatttgtttatcaaagaaattttaaaaaaacttaaatgaaaaattggttt |
12268283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 47940703 - 47940651
Alignment:
| Q |
97 |
gatttttatagtgcatcatctttttgctataatttgtttatcaaagaaatttt |
149 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||| |||| |||||| |||| |
|
|
| T |
47940703 |
gatttttatagtgtatcatctttttgctatgatttttttagtaaagaattttt |
47940651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University