View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12670_low_17 (Length: 261)
Name: NF12670_low_17
Description: NF12670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12670_low_17 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 105 - 261
Target Start/End: Complemental strand, 46928117 - 46927961
Alignment:
| Q |
105 |
ggaaggattaaatccaccaaataaagtcttgtggtggaaagatcaagttagctaatttagataagagaacataagtgagcatttgagaagaaagctttgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46928117 |
ggaaggattaaatccaccaaataaagtcttgtggtggaaagatcaagttagctaatttagataagagaacataagtgagcatttgagaagaaagctttgc |
46928018 |
T |
|
| Q |
205 |
atgtgcaactggaccatctacttttattatactgttaatattgtattagaaaaggac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46928017 |
atgtgcaactggaccatctacttttattatactgttaatattgtattagaaaaggac |
46927961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University