View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12671_high_16 (Length: 315)
Name: NF12671_high_16
Description: NF12671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12671_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 13158757 - 13159057
Alignment:
| Q |
1 |
tgatagtttaatacaaatggattctggaagttcaggtccatatgtgttgatggcaaacttgtatgccgagaaagggaattgggagaaagttgctgaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13158757 |
tgatagtttaatacaaatggatcctggaagttcaggtccatatgtgttgatggcaaacttgtatgccgagaaagggaattgggagaaagttgctgaagtg |
13158856 |
T |
|
| Q |
101 |
agaaaagggatgagagggaggggagtaaagaaggaagtgggattcagttgggtggatgttgctaatgttgattccttgcatttgcatggtttctcatctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13158857 |
agaaaagggatgagagggaggggagtaaagaaggaagtgggattcagttgggtggatgttgctaatgttgattccttgcatttgcatggtttctcatctg |
13158956 |
T |
|
| Q |
201 |
gcgacaagtcacacccagagtctgagactattgatagaatggcagagtttttgggattgcaaatgatattttcgaaagagagtggagggacaggaggtga |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13158957 |
gtgacaagtcacacccagagtctgagactattgatagaatggcagagtttttgggattgcaaatgatattttcgaaagagagtggagggacaggaggtga |
13159056 |
T |
|
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
13159057 |
t |
13159057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University