View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12671_low_29 (Length: 257)
Name: NF12671_low_29
Description: NF12671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12671_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 243
Target Start/End: Original strand, 8329419 - 8329649
Alignment:
| Q |
13 |
cgttcactgtgtaaaaaatctgaatagttcaatcggcaccatcgttatcgtgtcaatgggctatggtaaatttgtacagctgtgtaaaaaattgtacata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8329419 |
cgttcactgtgtaaaaaatctgaatagttcaatcggcaccatcgttatcgtgtcaatgggctatggtaaatttgtacagctgtgtaaaaaattgtacata |
8329518 |
T |
 |
| Q |
113 |
taaatcatgtaattaactgatattgtctttgcacaaagcaaatacaataaattcctaatgcttaacttccagatggtttcactttgtaagatcctctttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8329519 |
taaatcatgtaattaactgatattgtctttgcacaaagcaaatacaataaattcctaatgcttaacttccagatggtttcactttgtaagattctctttt |
8329618 |
T |
 |
| Q |
213 |
actttcctttgtcttggttaacatgatgtcc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8329619 |
actttcctttgtcttggttaacatgatgtcc |
8329649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University