View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12671_low_37 (Length: 229)
Name: NF12671_low_37
Description: NF12671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12671_low_37 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 34 - 229
Target Start/End: Original strand, 8022184 - 8022379
Alignment:
| Q |
34 |
tgttaagtatagcttagttctgattttgtacaagtacaaacttcctaaacttttctcaaccaacttctactatgcacaccccaccaccaccaattttgaa |
133 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8022184 |
tgttgagtatagcttagttctgattttgtacaagtacaaacttcctaaacttttctcaaccaacttctactatacacaccccaccaccaccaattttgaa |
8022283 |
T |
 |
| Q |
134 |
cctaattaattaagctcaggaatactttgtaaaacaggcttccatagcctatgatggacatcatggttgacacgatctctagcatttaacaaacca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
8022284 |
cctaattaattaagctcaggaatactttgtaaaacaggcttccatagcctatgatggacatcatggttgacatgatctctagcatttagcaaacca |
8022379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University