View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12672_high_4 (Length: 310)
Name: NF12672_high_4
Description: NF12672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12672_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 237 - 276
Target Start/End: Original strand, 33413253 - 33413292
Alignment:
| Q |
237 |
ttatttagttgagtgtttgtgagcaattgcatgtaacact |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33413253 |
ttatttagttgagtgtttgtgagcaattgcatgtaacact |
33413292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University