View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12672_low_13 (Length: 217)
Name: NF12672_low_13
Description: NF12672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12672_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 2563777 - 2563582
Alignment:
| Q |
1 |
cctctatacttgtcagcaaaatcaaacaactacaaaacatatgttattactgactgttattagatgtttgtttaactaattgatcaattattaataaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2563777 |
cctctatacttgtcagcaaaatcaaacaactacaaaacatatgttattactgactgttattagatgtttgtttaactaattgatcaatta---ataaact |
2563681 |
T |
|
| Q |
101 |
atataataatacttgaattgctcacagattttgaatgtcttaatagcttcaacgaatatttggtatcttttttcttaaagacaattgaagcagctgaaag |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2563680 |
atataata---cttgaattgctcacagattttgaatgtcttaatagcttcgacgaatatttggtatcttttttcttaaagacaattgaagcagctgaaag |
2563584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 112 - 200
Target Start/End: Complemental strand, 2573445 - 2573357
Alignment:
| Q |
112 |
cttgaattgctcacagattttgaatgtcttaatagcttcaacgaatatttggtatcttttttcttaaagacaattgaagcagctgaaag |
200 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||| | ||||| ||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
2573445 |
cttgaattgcttacagattttgactggcttaatagcttggatgaataattgatatctgttttcttaaagacaattgaagcagcagaaag |
2573357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 2573626 - 2573586
Alignment:
| Q |
1 |
cctctatacttgtcagcaaaatcaaacaactacaaaacata |
41 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | ||||||| |
|
|
| T |
2573626 |
cctctatacttatcagcaaaatcaaacaactgcgaaacata |
2573586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University