View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12672_low_14 (Length: 214)
Name: NF12672_low_14
Description: NF12672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12672_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 1185286 - 1185104
Alignment:
| Q |
14 |
ttcactgagagagattttctggtatgcttctctaaactatgtttctcggattctatcatacaccagaataag-aaaagtttaaaaacaagaaagcattat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
1185286 |
ttcactgagagagattttctggtatgcttctctaaactatgtttctcggattctatcatacaccagaataagaaaaagtttaaaaacaaaaaagcattat |
1185187 |
T |
|
| Q |
113 |
gaacaagttgtcc--nnnnnnnnntgaaccaggtatgattctacattccaagggcaaggtgtgattttaattataccacttat |
193 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1185186 |
gaacaagttatccaaaaaaaaaaatgaaccaggtatgattctacattccaagggcaaggtgtgattttaattataccacttat |
1185104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University