View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12672_low_6 (Length: 283)

Name: NF12672_low_6
Description: NF12672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12672_low_6
NF12672_low_6
[»] chr2 (1 HSPs)
chr2 (1-277)||(9433351-9433627)


Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-153
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 9433351 - 9433627
Alignment:
1 agtggtggtggaggtgatggtgtggttgaagttgttgaaccggagccttgcatggggtttttacaaagagagaatttctcgacggagattattgagagta 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9433351 agtggtgttggaggtgatggtgtggttgaagttgttgaaccggagccttgcatggggtttttacaaagagagaatttctcgacggagattattgagagta 9433450  T
101 tttcgccggaggatcttcaaccgacggtgaagctttgtgtggatggtttacagtcttcttcagtggctgtgaaacggtctgctgcggcgaaattgaggtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9433451 tttcgccggaggatcttcaaccgacggtgaagctttgtgtggatggtttacagtcttcttcagtggctgtgaaacggtctgctgcggcgaaattgaggtt 9433550  T
201 gcttgcaaagaatcgagctgataatcgtgttttgatcggtgaatccggtgctgtacctttgcttgttcctttgcttc 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9433551 gcttgcaaagaatcgagctgataatcgtgttttgatcggtgaatccggtgctgtacctttgcttgttcctttgcttc 9433627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University