View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_high_15 (Length: 229)
Name: NF12673_high_15
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_high_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 2 - 229
Target Start/End: Complemental strand, 49029920 - 49029693
Alignment:
| Q |
2 |
caggcaaaaaaccaaagggtacatctcttagtcttcaaacatttaatattgacaatctaaaatcaatgaattgacattagcacatggaagcatgtcgctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49029920 |
caggcaaaaaaccaaagggtacatctcttagtcttcaaacatttaatattgacaatctaaaatcaatgaattgacattagcacatggaagcatgtcgctt |
49029821 |
T |
|
| Q |
102 |
aaaatcatgaagtcaaaagtcaatagaagggaataaaggagaaagaaatctgattaggaaacaaatagagagagaggaatgaggg--nnnnnnntggaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
49029820 |
aaaatcatgaagtcaaaagtcaatagaagggaataaaggag--aggaatctgattaggaaacaaatagagagggaggaatgagggaaaaaaaaatggaga |
49029723 |
T |
|
| Q |
200 |
gcatggttgtcaaactcgagatttcaccta |
229 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
49029722 |
acatgattgtcaaactcgagatttcaccta |
49029693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University