View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_high_21 (Length: 210)
Name: NF12673_high_21
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 52423365 - 52423572
Alignment:
| Q |
1 |
ttcgaaggggattcgtctctggtgttgcacagccttttgggtatctggactgcatggtggtggctatagtttgcatttctgggagtcacgcagtttctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52423365 |
ttcgaaggggattcgtctctggtgttgcacagccttttgggtatctggactgcatggtggtggctatagtttgcatttctgggagtcacgcagtttgtgc |
52423464 |
T |
|
| Q |
101 |
gttgcagtcatcgttatggagtttatttttcaggtcagtggctttttgctctgttgatgcctcatttcctggaccttgtactgttagttttagtcttagg |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52423465 |
gttgcagtcatcgttgtggagtttatttttcaggtgagtggctttttgctctgttgatgcctcatttcgtggaccttgtactgttagttttagtcttagg |
52423564 |
T |
|
| Q |
201 |
actctgtg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
52423565 |
actctgtg |
52423572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University