View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_high_3 (Length: 372)
Name: NF12673_high_3
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 8577516 - 8577679
Alignment:
| Q |
18 |
attatatggattgaagaaaaagatggtagctggaatgatctctccaaagctcttattgttctcaaatgtgtgcttctcacttatttatactacaacttat |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8577516 |
attatatggattgaagaaaatgatggtagctggaatgatctctccaaaactcttattgttctcaaatgtgtgcttctcacttatttatactacaactcat |
8577615 |
T |
|
| Q |
118 |
ctaggataagctccattgttaat----tgaggaaaa-tccaaattttgtatagtaggtggaatg |
176 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8577616 |
ctaggttaagctccattgttaattaaatgaggaaaattccaaattttgtatagtaggtggaatg |
8577679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 247 - 359
Target Start/End: Complemental strand, 8597337 - 8597225
Alignment:
| Q |
247 |
tttgttagagtacattgaataagacgaaaaactaatgttttttggtctactnnnnnnntatttactcaatataaaaaataaagggaatactccaatagtt |
346 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||| ||||| ||| |
|
|
| T |
8597337 |
tttgttagagtacatggaataagacgaaaaactaatgtattttggtctactaaaaaaatatttactcaatataaaaaacaaagggaatattccaaccgtt |
8597238 |
T |
|
| Q |
347 |
ggcttcaatatct |
359 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8597237 |
ggcttcaatatct |
8597225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 68 - 105
Target Start/End: Complemental strand, 8597451 - 8597414
Alignment:
| Q |
68 |
tcttattgttctcaaatgtgtgcttctcacttatttat |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8597451 |
tcttaatgttctcaaatgtgtgcttctcacttatttat |
8597414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 8577782 - 8577827
Alignment:
| Q |
245 |
tgtttgttagagtacattgaataagacg-aaaaactaatgtttttt |
289 |
Q |
| |
|
||||||||||||||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
8577782 |
tgtttgttagagtacatggaataacacgaaaaaactaatgtttttt |
8577827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University