View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_high_5 (Length: 337)
Name: NF12673_high_5
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 41479812 - 41480018
Alignment:
| Q |
1 |
cttttagtccacttatgctagttctagttcttgaagttgtaatcttatgtaatgaaacctgttgagaagtaatgaaaagttaatttctggaatcctttct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41479812 |
ctttaagtccacttatgctagttctagttcttgaagttgtaatcttatgtaatgaaacctgttgagaagtaatgaaaagttaatttctggaatcctttct |
41479911 |
T |
 |
| Q |
101 |
tttaaattggtatcagttttctaagttgacatctcctcatgcctttttatcctctgtcgtctcttccacttagactcatgtagtttcagtttgcctttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41479912 |
tttaaattggtatcagttttctaagttgacatctcctcatgcctttttatcctctgtcgtctcttccacttagactcatgtagtttcagtttgcctttcc |
41480011 |
T |
 |
| Q |
201 |
gtttttg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
41480012 |
gtttttg |
41480018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 280
Target Start/End: Original strand, 24084511 - 24084564
Alignment:
| Q |
226 |
aaataaagacataagtcataactaagaaatccaaactactttctggttcatcctc |
280 |
Q |
| |
|
||||||||||||||| ||||||| | |||||| ||||||||||| |||||||||| |
|
|
| T |
24084511 |
aaataaagacataag-cataactcataaatcctaactactttctagttcatcctc |
24084564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University