View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_low_16 (Length: 238)
Name: NF12673_low_16
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 6194046 - 6193852
Alignment:
| Q |
1 |
agttaaatggttaattcatttaaatgtggaattgatatgacatgacattgtaagactgtattgatcaatcaacacacacattctttctctgttcaatcca |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6194046 |
agttaaatggttaattcagataaatgtggaattgatatgacatgacattgtaagactgtattgatcaatcaacacacacattctttctctgttcaatcca |
6193947 |
T |
|
| Q |
101 |
tcaactcatgtaaaacttttttcagtttttgaattgaaataacctctactcgttagacagtgtactcatgtgaactattgccaacatgttctacagtaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6193946 |
tcaactcatgtaaaacttttttcagtttttgaattgaaataacctctact-------cagtgtactcatgtgaactattgccaacatgttctacagtaca |
6193854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University