View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_low_21 (Length: 220)
Name: NF12673_low_21
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 31484817 - 31484629
Alignment:
| Q |
15 |
atagggacataaataaaggaaccacttgtagtaaatataatcacttatagactaacaaataatgaaaatgattttgttttatatcgatgtatgggaagta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31484817 |
atagggacataaataaaggaaccacttgtagtaaatataatcacttatattctaacaaataatgaaaatgattttgttttatatcgatgtatgggaagta |
31484718 |
T |
 |
| Q |
115 |
tatgagataacttattgactgaatatagggttatacacaaagttgttactgcttatcacccttaaaccaacggtcaagttgaactatgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31484717 |
tatgagataacttattgactgaatatagggttatacacagagttgttactgcttatcacccttaaaccaacggtcaagttgaactatgt |
31484629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University