View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12673_low_24 (Length: 212)

Name: NF12673_low_24
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12673_low_24
NF12673_low_24
[»] chr4 (2 HSPs)
chr4 (112-190)||(17888735-17888809)
chr4 (21-62)||(17888860-17888901)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 112 - 190
Target Start/End: Complemental strand, 17888809 - 17888735
Alignment:
112 agaagtatacatccaaactaaacatctatctaataatgaatactttcgaacaaaggcaattaactaaataaaaccgata 190  Q
    ||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||    
17888809 agaagtatacatccaaactaaacatcta----ataatgaatactttcgaacaaaggcaattaactaaataaaaccgata 17888735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 17888901 - 17888860
Alignment:
21 atcatctagactataacaatgcagtgttatgccgttagatgg 62  Q
    ||||||||||||||||||||||||||||||||||||||||||    
17888901 atcatctagactataacaatgcagtgttatgccgttagatgg 17888860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University