View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12673_low_5 (Length: 412)
Name: NF12673_low_5
Description: NF12673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12673_low_5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 6 - 412
Target Start/End: Original strand, 6194029 - 6194437
Alignment:
| Q |
6 |
tgaattaaccatttaactattctttgaactggaaatatgtattgcctcttatagcaactatttttgtctttcactctctctcactcacacctttttccat |
105 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6194029 |
tgaattaaccatttaactattctt-gaactggaaatatgtattgcctcttatagcaactatttttgtcattcactctctctcactcacacctttttccat |
6194127 |
T |
 |
| Q |
106 |
gcaaactttcacagtcattatcacattatcaatttttagcaacttaaaggcaacagttttggttttttctttgcagctttcaactgctgacac---nnnn |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6194128 |
gcaaactttcacagtcattatcacattatcaatttttagcaacttaaaggcaacagttttggttttttctttgcagctttcaactgctgacacaaaaaaa |
6194227 |
T |
 |
| Q |
203 |
nnnnntgagatgcttagaattaactttacattcttctcctttgccatcaccacaatttaagaaagtggatcttacccttttcaattctctccaaaaaatc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6194228 |
taatatgagatgcttagaattaactttacattcttctcctttgccatcaccacaatttaagaaagtggatcttacccttttcaattctctccaaaaaatc |
6194327 |
T |
 |
| Q |
303 |
aaatctttgcaagtccattttgctctttgtctaagattaaggttgtattagtcaaacattgtctcnnnnnnnntgtcttttttcttgtctcataccctct |
402 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
6194328 |
aaatctttgcatgtccattttgctctttgtctaagattaaggttgtattagtcaaacattgtctcaaaaaaaatgtcttttttcttgtctcatatcctct |
6194427 |
T |
 |
| Q |
403 |
ctgtgctcct |
412 |
Q |
| |
|
|||| |||| |
|
|
| T |
6194428 |
ttgtgttcct |
6194437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University