View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12674_high_3 (Length: 330)
Name: NF12674_high_3
Description: NF12674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12674_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 58 - 320
Target Start/End: Original strand, 51938016 - 51938287
Alignment:
| Q |
58 |
gcgttcctcttcagaaatagaggcaaagggagattgtgttgttgttgatgatctgataggagtgttaggagttgactt---------cttcttctgtaga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51938016 |
gcgttcctcttcagaaatagaggcaaagggagattgtgttgttgttgatgatctgataggagtgttaggagttgacttgttgttcttcttcttctgtaga |
51938115 |
T |
 |
| Q |
149 |
gaatgaagttcgtgaattgtttgggctttcaccgatgggctgctgtcgtcgtgacatatctccgaagaatccataactttcttgtgggtttggatcatgg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938116 |
gaatgaagttcgtgaattgtttgggctttcaccgatgggctgctgtcgtcgtgacatatctctgaagaatccataactttcttgtgggtttggatcatgg |
51938215 |
T |
 |
| Q |
249 |
gtagcccacgacgcccaacaacgttgtcaatagttgttccatttctgaaatctgatccattcttctcctttg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51938216 |
gtagcccacgacgcccaacaacgttgtcaatagttgttccatttctgaaatctgatccattcttctcttttg |
51938287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University