View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12674_low_6 (Length: 239)
Name: NF12674_low_6
Description: NF12674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12674_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 41281047 - 41281265
Alignment:
| Q |
1 |
tatggtgcaagctaaggcggttctaaatgctgaagagagacactctctccacaatggtggtatgttgaagaaactcaccataaggtttagtggtgatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41281047 |
tatggtgcaagctaaggcggttctaaatgctgaagagagacactctctccacaatggtggaatgttgaagaaactcaccataaggtttagtggtgatctc |
41281146 |
T |
|
| Q |
101 |
tccattttggttttaatattttttgggtttgtgctagctgaggactgaggagtactcttgcatgctctttggtttatataatgagattatataaga-gaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41281147 |
tccattttggttttaatattttttgggtttttgctag-------ctgaggagtactcttgcatgctctttggtttatataatgagattatataagaggaa |
41281239 |
T |
|
| Q |
200 |
tagagcatgtgataacttgataagtg |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41281240 |
tagagcatgtgataacttgataagtg |
41281265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University