View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12675_low_5 (Length: 228)
Name: NF12675_low_5
Description: NF12675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12675_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 98 - 212
Target Start/End: Complemental strand, 9352319 - 9352205
Alignment:
| Q |
98 |
ttcaatgttgacctggtgagttactctataatctgtcattgtaacaatgaaaacggaagagaatagaagttgaagaaacacttacataaataagcaactc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9352319 |
ttcaatgttgacctggtgagttactctataatctgtcattgtaacaatgaaaatggaagagaatagaagttgaagaaacacttacataaataagcaactc |
9352220 |
T |
 |
| Q |
198 |
taggatgagtctttt |
212 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9352219 |
taggatgagtctttt |
9352205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 9352367 - 9352319
Alignment:
| Q |
13 |
atcaccaaacaaaacatagcataacatgacctatgagtaattcatcaat |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9352367 |
atcaccaaacaaaacatagcataacatgacctatgagtaattcatcaat |
9352319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 650245 - 650208
Alignment:
| Q |
175 |
acacttacataaataagcaactctaggatgagtctttt |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
650245 |
acacttacataaataagcaactttaggatgagtctttt |
650208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 426665 - 426701
Alignment:
| Q |
176 |
cacttacataaataagcaactctaggatgagtctttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
426665 |
cacttacataaataagcaactctaggatgagtttttt |
426701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 52596158 - 52596118
Alignment:
| Q |
172 |
gaaacacttacataaataagcaactctaggatgagtctttt |
212 |
Q |
| |
|
|||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
52596158 |
gaaatacttacagagataagcaactctaggatgagtctttt |
52596118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University