View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12678_low_9 (Length: 239)
Name: NF12678_low_9
Description: NF12678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12678_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 14956887 - 14956678
Alignment:
| Q |
12 |
caaaggcaaaaaatcacccttattattagcacctaacaaagacatcatctcacttattatctccctaaattgtttagcttcttcaacatctgacacatct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14956887 |
caaaggcaaaaaatcacccttattattagcacctaacaaagacatcatctcacttattatctccctaaattgtttagcttcttcaacatctgacacatct |
14956788 |
T |
|
| Q |
112 |
ccgtcatctccataataccgttttcccgatatcattctcatcatagcattaaacgtcatctctgttagtctcggtctcagttccactttagtgaaaccga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14956787 |
ccgtcatctccataataccgttttcccgatatcattctcatcatagcattaaacgtcatctctgttagtctcggtctcagttccactttagtgaaaccga |
14956688 |
T |
|
| Q |
212 |
aaccttcaga |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
14956687 |
aaccttcaga |
14956678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University