View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_high_23 (Length: 284)
Name: NF12679_high_23
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 39319089 - 39318818
Alignment:
| Q |
1 |
tttgacactcaagtcagttagagagtaaatgattgagaggttttaggatagagtttgtgcatcatacatatgtgaggaaggcttgattttcgagttgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39319089 |
tttgacactcaagtcagttagagagtaaatgaa-gagaggttttaggatagagtttgtgcatcttacatatgcgaggaaggcttgattttcgagttgtta |
39318991 |
T |
 |
| Q |
101 |
gttgtttgaatgggaaccttacgaagcggtgtgccatcaatgtctatctttgtctattatgtgtcgttaggaagtttgagagtgaatggtccttggttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39318990 |
gttgtttgaatgggaaccttacgaagcggtgtgccatcaatgtctatctttgtctattatgtgtcgttaggacgtttgagagtgaacggtccttggttag |
39318891 |
T |
 |
| Q |
201 |
tcgttggaggcatttgggaagcaggatggatccaaggttgttgacttggttcgatgattgagtttggcctatg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318890 |
tcgttggaggcatttgggaagcaggatggatccaaggttgttgacttggttcgatgattgagtttggcctatg |
39318818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University