View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_high_26 (Length: 267)
Name: NF12679_high_26
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_high_26 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 6169610 - 6169366
Alignment:
| Q |
1 |
agaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169610 |
agaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaggttttcagatgatttcttcgcatatattccggtagaggaa |
6169511 |
T |
 |
| Q |
101 |
tagctgtgcggacggtctcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
6169510 |
tagctgtgcggacggtctcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttattcgggaaccgttcttttcggaccgtttcg |
6169411 |
T |
 |
| Q |
201 |
gttagcctaaataccgttttccttcattttgtttatgttttcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169410 |
gttagcctaaataccgttttccttcattttgtttatgttttcttc |
6169366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 8500731 - 8500818
Alignment:
| Q |
1 |
agaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattc |
89 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||| |||||||| || || |||| | || | ||| || |||||||||||||||||||| |
|
|
| T |
8500731 |
agaacgcatctctggtgcccatccgtttgagaaacaggtggcataattgttttc-ggcaggattttaggtgatttcttcgcatatattc |
8500818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 32879616 - 32879858
Alignment:
| Q |
10 |
ctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagctgtgc |
109 |
Q |
| |
|
|||||||||||||| |||||| ||| | |||||||| |||||||||||| |||||||| ||||||||||||||||||| ||| || ||||||| ||||| |
|
|
| T |
32879616 |
ctctggtgccgatccgtttgaaaaaccgatggcacaattgctttctgacatgttttcaggtgatttcttcgcatatattacgggaggggaatagttgtgc |
32879715 |
T |
 |
| Q |
110 |
ggacggtc-------tcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcggt |
202 |
Q |
| |
|
||| |||| ||||||||| | |||||||||||||||||||||||| |||||||| ||| ||||| || ||||||| || ||||||||| || |
|
|
| T |
32879716 |
ggatggtcgtgctaatcatggtcacaatattcagggtgtttggtggtccaccgctcttccagattttattcagggttcgttcttttcagaccgtttcagt |
32879815 |
T |
 |
| Q |
203 |
tagcctaaataccgttttccttcattttgtttatgttttcttc |
245 |
Q |
| |
|
| ||||||||| |||||||||| |||| ||| |||||||||| |
|
|
| T |
32879816 |
tggcctaaatatcgttttccttaatttaatttttgttttcttc |
32879858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 245
Target Start/End: Original strand, 14103209 - 14103335
Alignment:
| Q |
118 |
tcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcggttagcctaaataccgt |
217 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||| ||||| || || ||||||||||||| ||||||||| ||| |
|
|
| T |
14103209 |
tcatggtcacagtactcagggtgtttggtggtccactgctcttctagatgttattcgggatccgttttt-tcagaccgtttcggttggcctaaatatcgt |
14103307 |
T |
 |
| Q |
218 |
tttccttcattttgtttatgttttcttc |
245 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
14103308 |
tttccttaattttgtttatgttttcttc |
14103335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 14103117 - 14103203
Alignment:
| Q |
1 |
agaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatat |
87 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||||||| |||| |||| ||||| || ||||||||||| |||||| |
|
|
| T |
14103117 |
agaaagcctctctggtgccgatccgtttgagaaacaggtggcacaactgttttccgacaggttttaaggtgatttcttcgaatatat |
14103203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 6 - 230
Target Start/End: Original strand, 153178 - 153410
Alignment:
| Q |
6 |
gcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagct |
105 |
Q |
| |
|
|||||| ||||||||||| |||||||||| ||||| |||||||||||| ||| |||||||| || |||||||||||||||| | | || ||||||| | |
|
|
| T |
153178 |
gcctctttggtgccgatccgtttgagaaacaggtgccacaactgcttttcaacaggttttcaggtggtttcttcgcatatatttcaggaggggaatagtt |
153277 |
T |
 |
| Q |
106 |
gtgcggacggtc-------tcatggtcagagtattcagggtgt-ttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtt |
197 |
Q |
| |
|
||||||| |||| | ||||||| |||||||||| ||| |||||| ||||||| |||||| || ||||| ||| |||||||| || |||| || |
|
|
| T |
153278 |
gtgcggatggtctagctaataatggtcacagtattcaggatgtgttggtgatccactgttcttccatattttattcaggagccgttcttttcagaccatt |
153377 |
T |
 |
| Q |
198 |
tcggttagcctaaataccgttttccttcatttt |
230 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||||| |
|
|
| T |
153378 |
tcggttagcctaaatattgtttttctttatttt |
153410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 162
Target Start/End: Complemental strand, 41444031 - 41443870
Alignment:
| Q |
8 |
ctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagctgt |
107 |
Q |
| |
|
|||||||||| |||| |||||||||| ||||||||||||||||| | |||| |||||||| ||||| |||| |||||||||||| || ||||||| ||| |
|
|
| T |
41444031 |
ctctctggtgttgatccgtttgagaaacaggtggcacaactgcttaccgacaggttttcaggtgattccttcacatatattccgggaggggaatagttgt |
41443932 |
T |
 |
| Q |
108 |
gcggacggtc-------tcatggtcagagtattcagggtgtttggtggtccactgctcttcc |
162 |
Q |
| |
|
||||| ||| |||| |||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
41443931 |
gcggatagtccagctaatcatcgtcaccgtattcaaggtgtttggtggtccactactcttcc |
41443870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University