View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_high_28 (Length: 255)
Name: NF12679_high_28
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_high_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 255
Target Start/End: Original strand, 7924615 - 7924859
Alignment:
| Q |
10 |
cagagacaagaaatggaacgagtacattaacatcacgattaaatccaaaatcagtggcccacaatcttagcttctctcagtcatcgtctttgaattctct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924615 |
cagagacaagaaatggaacgagtacattaacatcacgattaaatccaaaatcagtg-cccacaatcttagcttctctcagtcatcgtctttgaattctct |
7924713 |
T |
 |
| Q |
110 |
gatcaaatattaaacacaaaatagtgttagcaattttcatggttattgcaaaacgtgtgccaaatgacaaaattaccatggtatacataatgactaaact |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924714 |
gatcaaatattaaacacaaaatagtgttagcaattttcatggttattgcaaaacgtgtgccaaatgacaaaattaccatggtatacataatgactaaact |
7924813 |
T |
 |
| Q |
210 |
aattcattattaaattattacaaaggggaaaataagattgaacacc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924814 |
aattcattattaaattattacaaaggggaaaataagattgaacacc |
7924859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University