View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12679_high_29 (Length: 253)

Name: NF12679_high_29
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12679_high_29
NF12679_high_29
[»] chr5 (1 HSPs)
chr5 (19-146)||(1156773-1156900)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 146
Target Start/End: Original strand, 1156773 - 1156900
Alignment:
19 agaatagtgagctgattttttcatatatctgaaggtggataagggaatggatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattat 118  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
1156773 agaatagtgagctgaatttttcatatatctgaaggtggagaagggaatagatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattat 1156872  T
119 ttttaattaaacattgatgaatttcttg 146  Q
    ||||||||||||||||||||||||||||    
1156873 ttttaattaaacattgatgaatttcttg 1156900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University