View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_high_29 (Length: 253)
Name: NF12679_high_29
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 146
Target Start/End: Original strand, 1156773 - 1156900
Alignment:
| Q |
19 |
agaatagtgagctgattttttcatatatctgaaggtggataagggaatggatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattat |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1156773 |
agaatagtgagctgaatttttcatatatctgaaggtggagaagggaatagatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattat |
1156872 |
T |
 |
| Q |
119 |
ttttaattaaacattgatgaatttcttg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1156873 |
ttttaattaaacattgatgaatttcttg |
1156900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University