View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_high_37 (Length: 215)
Name: NF12679_high_37
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 2431596 - 2431417
Alignment:
| Q |
19 |
aatgtttcatattctcatccatttagatacttagatgcgcttcagcaagttccgcaagtaagatcggatctctccaaccatctcatcagcaaacagacca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431596 |
aatgtttcatattctcatccatttagatacttagatgcgcttcagcaagttccgcaagtaagatcggatctctccaaccatctcatcagcaaacagacca |
2431497 |
T |
 |
| Q |
119 |
tccctaaaaaacaaattgtatcatatcagtaagagcatcattacgtttctaaataaaaactaatataatacactatgtca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431496 |
tccctaaaaaacaaattgtatcatatcagtaagagcatcattacgtttctaaataaaaactaatataatacactatgtca |
2431417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 19 - 95
Target Start/End: Complemental strand, 2431713 - 2431637
Alignment:
| Q |
19 |
aatgtttcatattctcatccatttagatacttagatgcgcttcagcaagttccgcaagtaagatcggatctctccaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431713 |
aatgtttcatattctcatccatttagatacttagatgcgcttcagcaagttccgcaagtaagatcggatctctccaa |
2431637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University