View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_low_17 (Length: 296)
Name: NF12679_low_17
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 9 - 279
Target Start/End: Original strand, 7924844 - 7925114
Alignment:
| Q |
9 |
aataagattgaacaccgtacctacgatcaaggtaacgaggttgaattccagatccttgacaagttgtgcatgtcagtgaacccgcaccatcacaattgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924844 |
aataagattgaacaccgtacctacgatcaaggtaacgaggttgaattccagatccttgacaagttgtgcatgtcagtgaacccgcaccatcacaattgat |
7924943 |
T |
|
| Q |
109 |
gcagcgagagacctccgtctcagctccaccaagttcaacagtcacattaccggttcctaaacaaaatctgcatttctctggcaaaagtgcaacattttca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924944 |
gcagcgagagacctccgtctcagctccaccaagttcaacagtcacattaccggttcccaaacaaaatctgcatttctctggcaaaagtgcaacattttca |
7925043 |
T |
|
| Q |
209 |
aagataagattggtaaagaaattatcaacctgatgtggatttgaactgattacattcacaacctaatgtct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7925044 |
aagataagattggtaaagaaattatcaacctgatgtggatttgaactgattacattcacaacctaatgtct |
7925114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University