View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_low_23 (Length: 285)
Name: NF12679_low_23
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 22 - 276
Target Start/End: Original strand, 44816165 - 44816420
Alignment:
| Q |
22 |
atgtcaccaccttgaggcatcacaatcaacagttaacattttccggcacttgaacaggtaaagacggttgaaggcacttctgaactacaaatccctgctg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816165 |
atgtcaccaccttgaggcatcacaatcaacagttaacatttttcggcacttgaacaggtaaagacggttgaaggcacttctgaactacaaatccctgctg |
44816264 |
T |
 |
| Q |
122 |
gtacccaacctggagatgtcctcgtccttgcaaggaagggtgtaccgaaattaaacagaccgtcaatacgtggtgaccacttatttactgttaaagttac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816265 |
gtacccaacctggagatgtcctcgtccttgcaaggaagggtgtaccgaaattaaacagaccgtcaatacgtggtgaccacttatttactgttaaagttac |
44816364 |
T |
 |
| Q |
222 |
aataccaaaacgtatcaggtaatgagtcattttatagtttt-attttgtttctctg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44816365 |
aataccaaaacgtatcaggtaatgagtcattttatagttttgattttgtttctctg |
44816420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University