View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_low_33 (Length: 253)
Name: NF12679_low_33
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 236
Target Start/End: Original strand, 40743560 - 40743791
Alignment:
| Q |
3 |
aggaggagcagagaccatccttccttttagcttgatgtccattttaaaatctacagtattataatcctattttggctgtgttgatgttcaacaactagct |
102 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40743560 |
aggaggatcagtgaccatccttcctt--agcttgatgtccattttaaaatctacagtattataatcctattttggctgtgttgatgttcaacaactagct |
40743657 |
T |
|
| Q |
103 |
tagttagatttctaagatactcacctaatgggaatttaaacattaattcagctcaatattgaccgacctattacgtaatagacaattcaactgtttttgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40743658 |
tagttagatttctaagatactcacctaatgggaatttaaacattaattcagctcaatattgaccgacctattacgtaatagacaattcaactgtttttgt |
40743757 |
T |
|
| Q |
203 |
cttcaactatttggagcttctcacgatctaatct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40743758 |
cttcaactatttggagcttctcacgatctaatct |
40743791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University