View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_low_35 (Length: 241)
Name: NF12679_low_35
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_low_35 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 123 - 241
Target Start/End: Complemental strand, 37863936 - 37863818
Alignment:
| Q |
123 |
gaaaattaggctcgcctccccaaaacaacacaaacaccttctctagttttgtactagacactaacctccactaagttattctataatagacaaacacatc |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863936 |
gaaaattaggctcgcccgcccaaaacaacacaaacaccttctctagttttgtactagacactaacctccactaagttattctataatagacaaacacatc |
37863837 |
T |
 |
| Q |
223 |
ccttaacacaattattatt |
241 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
37863836 |
ccttaacaccattattatt |
37863818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 37864932 - 37864837
Alignment:
| Q |
18 |
ataatatgcaattagatacgactctgaggtacaaatatttagtaactgaaacatcttaagtaagattaagttcgattgattgaacctatatcaaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37864932 |
ataatatgcaattagatacgactctgaggtacaaatatttagtaactgaaacatcttaaataagattaagttcgattgattgaaccgatatcaaat |
37864837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University