View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_low_37 (Length: 237)
Name: NF12679_low_37
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 10215843 - 10216051
Alignment:
| Q |
1 |
tagtagtagtagtagtgaaatagttcggtggactatttaaatgaatgataaataacaagtcacaaaaattattcaaatgaaatacttataatgtgacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
10215843 |
tagtagtagtagtagtgaaatagttcggtggactatttaaatgaatgacaaataacaagtcacaaaaattattcaaatgaaacacttataatgtgaaaga |
10215942 |
T |
|
| Q |
101 |
gccacagaggtagtatctaatatggaaatattaagtttctggcttttattttgattttcaggctgcatgggatgaattcgatgaagaggagtcagactgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10215943 |
gccacagaggtagtatctaatatggaaataataagtttctggcctttattttgattttcaggctgcatgggatgaattcgatgaagaggagtcagactgt |
10216042 |
T |
|
| Q |
201 |
ggcatcgaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
10216043 |
ggcatcgaa |
10216051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University