View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12679_low_40 (Length: 218)
Name: NF12679_low_40
Description: NF12679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12679_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 37863476 - 37863573
Alignment:
| Q |
11 |
cagagaagtagaaactagagggaacaaggagaaaaaggacaaaaatggattagtgattctattttgatttatgcacgggttgctttgtctgctgctgc |
108 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863476 |
cagacaagtagaaagtagagggaacaaggagaaaaaagacaaaaatggattagtgattctattttgatttatgcacgggttgctttgtctgctgctgc |
37863573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 108 - 203
Target Start/End: Original strand, 37863604 - 37863697
Alignment:
| Q |
108 |
ctgaatcaactttgttgttgttgctcggtgtgggtgtgggtgaagaaagaataagactgattacaattttcagaatttactcgctattgttgtgag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863604 |
ctgaatcaactttgttgttgttgctcggtg--ggtgtgggtgaagaaagaataagactaattacaattttcagaatttactcgctattgttgtgag |
37863697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University