View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268-Insertion-2 (Length: 71)
Name: NF1268-Insertion-2
Description: NF1268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268-Insertion-2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 41894498 - 41894436
Alignment:
| Q |
8 |
tacaaaagttatgtcaagcatatgaaagagtttgttataagtactgatcaattttactttgat |
70 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41894498 |
tacaaaagttatgtcaagcatatgaaaaagtttgttataagtactgatcaattttactttgat |
41894436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 36758911 - 36758974
Alignment:
| Q |
7 |
atacaaaagttatgtcaagcatatgaaagagtttgttataagtactgatcaattttactttgat |
70 |
Q |
| |
|
||||||||| || ||||||| |||||| |||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
36758911 |
atacaaaagctacatcaagcagatgaaaaagttagttatcagtactgatcaattatactttgat |
36758974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University