View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268-Insertion-4 (Length: 327)
Name: NF1268-Insertion-4
Description: NF1268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 8 - 327
Target Start/End: Original strand, 10190737 - 10191056
Alignment:
| Q |
8 |
tgcttctagtaaccaaagtgatcccattcttcaaatccttgatgattctattgccaccttccgagttcatcgccgttccattttgcgcactgctcgttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10190737 |
tgcttctagtaaccaaagtgatcccattcttcgaatccttgatgattctattgccaccttccgagttcatcgccgttccattttgcgcactgctcgttat |
10190836 |
T |
|
| Q |
108 |
gatgatgacgatcctgttgagccaaatgactcacccgacactcccaagctgtgtttctctcttgaacctattccaccaaatgcaccaactagttttcacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10190837 |
gatgatgacgatcctgttgagccaaatgactcacccgacactcccaagctgtgtttctctcttgaacctattccaccaaatgcaccaactagttttcacc |
10190936 |
T |
|
| Q |
208 |
aggctttgcaagtgaccaatcatgcctcgtgtccttgcagctcctcatcgatgttacattcttcacctatgcatacgccttatatcacatgtccttcctc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10190937 |
aggctttgcaagtgaccaatcatgcctcatgtccttgcagctcctcatcgatgttacattcttcacctatgcatacgccttatatcacatgtccttcctc |
10191036 |
T |
|
| Q |
308 |
taatagagcttatctttcag |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10191037 |
taatagagcttatctttcag |
10191056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 33722300 - 33722346
Alignment:
| Q |
159 |
tgtttctctcttgaacctattccaccaaatgcaccaactagttttca |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33722300 |
tgtttctctcttgaacagattccaccaaatgcaccaactagttttca |
33722346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University