View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_high_10 (Length: 398)
Name: NF12680_high_10
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 19 - 392
Target Start/End: Complemental strand, 10416620 - 10416247
Alignment:
| Q |
19 |
cttcttcacaaggagatggaagtagttcacaaggtgactcatgtgacaccaagctaaacctcagtgttcctctcccctttgacacaaccaagctcaattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416620 |
cttcttcacaaggagatggaagtagttcacaaggtgactcatgtgacaccaagctaaacctcagtgttcctctcccctttgacacaaccaagctcaattg |
10416521 |
T |
 |
| Q |
119 |
tcttgctgtttggaatgctcaaggatacatcctcagagtaagtgcattactctttaacttaaccagtttttatctatctatattcaaattttgaatgtcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416520 |
tcttgctgtttggaatgctcaaggatacatcctcagagtaagtgcattactctttaacttaaccagtttttatctatctatattcaaattttgaatgtcg |
10416421 |
T |
 |
| Q |
219 |
atacttgcaatacaatcatcataattgcaaccacattttctcggcgtctccaatctctacggtcaaaagttggtcgtcggctgcaaaggatggagacgct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10416420 |
atacttgcaatacaatcatcataattgcaaccacatcttctcggcgtctccaatctctatggtcaaaagttgggggccggctgcaaaggatggagacgct |
10416321 |
T |
 |
| Q |
319 |
gaagaggatgcgagctcaattaattttgaatttgaatcccattttgagtcttactactcagatattcatctcac |
392 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
10416320 |
gaagaggatgcgagctcaattaattctgaatttgaatcccatttcgagtcttactactcatatattcatgtcac |
10416247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University