View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_19 (Length: 295)
Name: NF12680_low_19
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 19 - 150
Target Start/End: Original strand, 1287904 - 1288034
Alignment:
| Q |
19 |
cgatcgtgctcagtccattttagagaatgaactcagttaagcaaacaaatttctaaactcagttaagcaaattgtatgcctcttgcctgtaacnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287904 |
cgatcgtgctcagtccattttagagaatgaactcagttaagcaaacaaatctctaaactcagttaagcaaattgtatgcctcttgcctgtaac-aaaaaa |
1288002 |
T |
 |
| Q |
119 |
tcttcccacacttgatacatcacaatactact |
150 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
1288003 |
tcttcccacacttgatacatcataatactact |
1288034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 280
Target Start/End: Original strand, 1288037 - 1288090
Alignment:
| Q |
227 |
atttatatatcgtttggaattcattccaactaatcaattattctgggagccagt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1288037 |
atttatatatcgtttggaattcattccaactaatcaatgattctgggagccagt |
1288090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University