View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_26 (Length: 277)
Name: NF12680_low_26
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 2096796 - 2096528
Alignment:
| Q |
1 |
tacaaaaggaggatactccacttccgttgtagtacatgaaaggtaaacttaatagatggcttcgttctgattatgttttatgcgtttttacaagaccttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096796 |
tacaaaaggaggatactccacttccattgtagtacatgaaaggtaaacttaatagatggcttcgttctgattatgttttatgcgtttttacaagaccttc |
2096697 |
T |
|
| Q |
101 |
tcttgctgaaatttattataagcactaaaaacacttatttgatttcgtaataatggaggttgtaatttcagtccataacttcttttatatatggtcttgc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2096696 |
tcttgcttaaatttattataagcactaaaaacacttatttgatttcgtaataatggaggttgtaatttcagttcataacttcttttatatatggtcttgc |
2096597 |
T |
|
| Q |
201 |
atgtgcaggtattgcttcttgatacctaaaagctatcctctagcttcagcaggtcctttgctctgtgct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096596 |
atgtgcaggtattgcttcttgatacctaaaagctatcctctagcttcagcaggtcctttgctctgtgct |
2096528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 101 - 269
Target Start/End: Complemental strand, 2102908 - 2102740
Alignment:
| Q |
101 |
tcttgctgaaatttattataagcactaaaaacacttatttgatttcgtaataatggaggttgtaatttcagtccataacttcttttatatatggtcttgc |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || | ||||||||| ||| ||||| |||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
2102908 |
tcttgctgaaatttattatgagcactaaaaaaacatctttgatttcataacgatggaagttgtaatttcagttcataacttcttttatatttggtcttgc |
2102809 |
T |
|
| Q |
201 |
atgtgcaggtattgcttcttgatacctaaaagctatcctctagcttcagcaggtcctttgctctgtgct |
269 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
2102808 |
atatgcaggtattgcttcttgatacctaaaagctatcctttagcttcggcaggtcctttgctttgtgct |
2102740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 2102981 - 2102908
Alignment:
| Q |
1 |
tacaaaaggaggatactccacttccgttgtagtacatgaaaggtaaacttaatagatggcttcgttctgattat |
74 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
2102981 |
tacaaaaggaggatactcgacttcaattgtagtaaatgaaaggtaaacttaatagagggcttggttctgattat |
2102908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University