View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_32 (Length: 246)
Name: NF12680_low_32
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 37718188 - 37717954
Alignment:
| Q |
1 |
aaaaaatacttgggaatatggtatcacgatctggaaccacaaacagtggtttgggtagccaacagaaacaaccctattgtagattctaaaggagtttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37718188 |
aaaaaatacttgggaatatggtatcacgatctggaaccacaaacagtggtttgggtagccaacagaaacaaccctattgtagattctaaaggagtttttc |
37718089 |
T |
 |
| Q |
101 |
aaatcgcaaaggatggaaatatggtagtagcagatgcatcacaaagttactggtccacaaacttagaagcgtcctcatcaagaaccagggtagtgaagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
37718088 |
aaatcgcaaaggatggaaatatggtagtagcagatgcatcacaaagttactggtccacaaacttagaagcgtcctcgtcaagaaaaagggtagtgaagct |
37717989 |
T |
 |
| Q |
201 |
cttggattctggaaacctagtgcttattgatgatg |
235 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37717988 |
cttggattctggaaacctagtgcttatggatgatg |
37717954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University