View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_34 (Length: 237)
Name: NF12680_low_34
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 38040284 - 38040495
Alignment:
| Q |
12 |
acagacttggacttcatgttttggatttgagaaaattgacatgactacaaaagaattactcaagaccaaaaatgtggtaaaattctatggagtggaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38040284 |
acagacttggacttcatgttttggatttgagaaaattgacatgactacaaaagaattactgaagaccaaaaatgtggtgaaattctatggagtggaaatg |
38040383 |
T |
|
| Q |
112 |
cttcaaaagaaaatacaaaagcttgagcttcctgaaggaaatctggatttcaatcaaggtatgtatacattttggtagaaacctaacgagctaaattaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040384 |
cttcaaaagaaaatacaaaagcttgagcttcctgaaggaaatctggatttcaatcaaggtatgtatacattttggtagaaacctaacgagctaaattaga |
38040483 |
T |
|
| Q |
212 |
taggttcttttt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38040484 |
taggttcttttt |
38040495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University