View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_37 (Length: 219)
Name: NF12680_low_37
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_37 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 2097014 - 2096796
Alignment:
| Q |
1 |
ttatctgtgttttccttttttcttatcagacacgagattgctggggttgtggcaaaggttggtcccaatgtccagcgtttcaaggttggtgaccatgtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097014 |
ttatctgtgttttccttttttcttatcagacacgagattgctggggttgtggcaaaggttggtcccaatgtccagcgtttcaaggttggtgaccatgtcg |
2096915 |
T |
|
| Q |
101 |
gagtggggacttacatcaactcatgcagggaatgtgagtattgtaacgatcgattagaagttcattgtgtcaagggatcagtttacacctttaatggtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096914 |
gagtggggacttacatcaactcatgcagggaatgtgagtattgtaacgatcgattcgaagttcattgtgtcaagggatcagtttacacctttaatggtgt |
2096815 |
T |
|
| Q |
201 |
tgattatgatggcacaatt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2096814 |
tgattatgatggcacaatt |
2096796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 161 - 219
Target Start/End: Complemental strand, 2103039 - 2102981
Alignment:
| Q |
161 |
ttcattgtgtcaagggatcagtttacacctttaatggtgttgattatgatggcacaatt |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
2103039 |
ttcattgtgccaagggatcagtttacacctttaattgtgttgattatgatggtacaatt |
2102981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University