View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_38 (Length: 210)
Name: NF12680_low_38
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_38 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 76 - 210
Target Start/End: Complemental strand, 45692619 - 45692485
Alignment:
| Q |
76 |
taacataacatagtagaatttggagtaaatcaacattttagtcctaaaattgaaagggtcgtcaatttagtctctaagattttcgaaacatgaatttaaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45692619 |
taacataacatagtagaatttggagtaaatcaacattttaatcctaaaattgaaagggtcgtcaatttagtctctaagattttcgaaacatgaatttaaa |
45692520 |
T |
|
| Q |
176 |
tctttaaattgaacaatgtcattcaacttagtact |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
45692519 |
tctttatattgaacaatgtcattcaacttagtact |
45692485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 6 - 82
Target Start/End: Complemental strand, 45693108 - 45693032
Alignment:
| Q |
6 |
aacatgagtggttttagctatgatactttatggaatttgagaaagagattcagaaatcaaactcgagtattaacata |
82 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693108 |
aacatgagtggtattagctatgataccttatggaatttgagaaagagattcagaaatcaaactcgagtattaacata |
45693032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University