View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12680_low_6 (Length: 438)
Name: NF12680_low_6
Description: NF12680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12680_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 63 - 426
Target Start/End: Complemental strand, 736531 - 736168
Alignment:
| Q |
63 |
agaaacacatcattcattgtaatcctagaacaccttttatggaagactagatcctttcagattcccattgaacaatgaattcttctggcaaaatggaatg |
162 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
736531 |
agaaatacatcattcattgtaatcctagaacaccttttatggaagactagatcctttcagattcccattgaacaatgacttcttcaggcaaaatggaatg |
736432 |
T |
|
| Q |
163 |
caaatggtgcagcttcaactccttgaaacatcttggatttggacaattaaactccattacactctggcttagttgtgcagccacatgattagatatacaa |
262 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
736431 |
caaatgttgcggcttcaactcctcgaaacatcttggatttggacaattaaactccattacactctggcttagttgtgcagccacatgattagatatacaa |
736332 |
T |
|
| Q |
263 |
ttagcacaaaatggatggttacatgtgccactacctctaacaatatcattctctggtacaaaatcaaaacatataccacaaaaggattttgatgactgtt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
736331 |
ttagcacaaaatggatggttacatgtgccactacctctaacaatatcattctctggtacaaaatcaaaacatacaccacaaaaggattttgatgactgtc |
736232 |
T |
|
| Q |
363 |
gagaaccagtttcggtctccatggcagctgctgcttctttccccttcttttgttgtttgaattc |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
736231 |
gagaaccagtttcggtctccatggcagctgctgcttctttccccttcttttgttgtttgaattc |
736168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 69
Target Start/End: Complemental strand, 736632 - 736583
Alignment:
| Q |
20 |
catctgatagaaaacttcattacacatttcatggcatgtgcatagaaaca |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
736632 |
catctgatagaaaacttcattacacatttcatggcatgtgcatagaaaca |
736583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 227 - 273
Target Start/End: Original strand, 1455207 - 1455253
Alignment:
| Q |
227 |
tggcttagttgtgcagccacatgattagatatacaattagcacaaaa |
273 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
1455207 |
tggcttagttgttcagccacatgcttagatatacaattggcacaaaa |
1455253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University