View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12682_low_20 (Length: 278)
Name: NF12682_low_20
Description: NF12682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12682_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 7451436 - 7451176
Alignment:
| Q |
1 |
taaaatattactcccattactacgtgcttagtttaatatcagtggctatatcaattttttaagtaagtgtatatgcatggctgtgaactgaacgggtaag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7451436 |
taaaatattactcccattaccacgtgcttaatttaatatcagtggctatatcaattttttaagtaagtgtatatgcatggttgtgaactgaacgggtaag |
7451337 |
T |
|
| Q |
101 |
cctccactgttcctttccttctttatgcttcacctatagctctagttttcaacaacccctaaattgcgccacaattcgggcattagcttaatttgttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7451336 |
cctccactgttcctttccttctttatgcttcacctatagctctagttttcaacaacccctaaattgcgccacaattggggcattagcttaatttgttcat |
7451237 |
T |
|
| Q |
201 |
cactgtctagctctaacttcgaggttgagagactagagtggctcacacacccccacgaaat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451236 |
cactgtctagctctaacttcgaggttgagagactagagtggctcacacacccccacgaaat |
7451176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 253
Target Start/End: Complemental strand, 7437839 - 7437794
Alignment:
| Q |
208 |
tagctctaacttcgaggttgagagactagagtggctcacacacccc |
253 |
Q |
| |
|
||||||||||||| ||| |||| || |||||||||||||||||||| |
|
|
| T |
7437839 |
tagctctaacttcaaggatgagggagtagagtggctcacacacccc |
7437794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University