View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12682_low_21 (Length: 276)
Name: NF12682_low_21
Description: NF12682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12682_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 264
Target Start/End: Complemental strand, 52296690 - 52296446
Alignment:
| Q |
20 |
ctctgttagactgaaaaggttgagaagaggattggttccaggatactttgccattactaccagcagttattttaaaaccagagactaccaattccaagca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296690 |
ctctgttagactgaaaaggttgagaagaggattggttccaggatactttgccattactaccagcagttattttaaaaccagagactaccaattccaagca |
52296591 |
T |
|
| Q |
120 |
ccataaatctggattgttttgccatagcacgaaacctcctacttcagctttgcctcttgaatgaacgctgttatcatcggcaccatgacgcatctctgaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296590 |
ccataaatctggattgttttgccatagcacgaaacctcctacttcagctttgcctcttgaatgaacgctgttatcatcggcaccatgacgcatctctgaa |
52296491 |
T |
|
| Q |
220 |
ccatgtattctaacttctcccattgcatacatgttttgcagtgaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52296490 |
ccatgtattctaacttctcccattgcatacatgttttgcaatgaa |
52296446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 94 - 167
Target Start/End: Complemental strand, 6826420 - 6826347
Alignment:
| Q |
94 |
aaaccagagactaccaattccaagcaccataaatctggattgttttgccatagcacgaaacctcctacttcagc |
167 |
Q |
| |
|
||||||||||| |||||||| ||| ||| ||||||||||| |||||||| | || |||||||| |||||||| |
|
|
| T |
6826420 |
aaaccagagacaaccaattcaaagtgccacaaatctggattcttttgccacaatacaaaacctcccacttcagc |
6826347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University