View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12682_low_26 (Length: 250)
Name: NF12682_low_26
Description: NF12682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12682_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 94 - 193
Target Start/End: Original strand, 27826866 - 27826965
Alignment:
| Q |
94 |
gggaataacattgaattcaacccgccgaaaaacccaaaacttctccagataacgcaactggggttcatcgtcaaccgccattatcattgagaacgtccgt |
193 |
Q |
| |
|
|||||||||| |||||||||| ||||| |||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
27826866 |
gggaataacactgaattcaactcgccggaaaaaccaaaacttctccggataacgcaactggggttcgtcgtcaaccgccattatcattgagaaggtccgt |
27826965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 94 - 198
Target Start/End: Original strand, 27831446 - 27831550
Alignment:
| Q |
94 |
gggaataacattgaattcaacccgccgaaaaacccaaaacttctccagataacgcaactggggttcatcgtcaaccgccattatcattgagaacgtccgt |
193 |
Q |
| |
|
|||||||||| |||| ||||| ||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
27831446 |
gggaataacactgaactcaactcgccggaaaaaccaaaacttcaccagataacgcaactggggttcatcgtcaaccgcctttatcattgagaaggtccgt |
27831545 |
T |
 |
| Q |
194 |
gcaag |
198 |
Q |
| |
|
|||| |
|
|
| T |
27831546 |
ccaag |
27831550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 27831356 - 27831396
Alignment:
| Q |
4 |
gatgtttttgtattttttcgtttgtcccatcaattccttag |
44 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
27831356 |
gatgtgtttgtaatttttcgtttgtcccatcaattccttag |
27831396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University