View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12682_low_28 (Length: 245)
Name: NF12682_low_28
Description: NF12682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12682_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 18168935 - 18168722
Alignment:
| Q |
14 |
cagagagaaaggaagagaaacattcattagaagatataagagacatcaaaaattctagtgctatttcacttgaattgccactaatggccatgcactctaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18168935 |
cagagagaaaggaagagaaacattcattagaagatataagagacttcaaaaattctagtgctatttcacttgaattgccactaatggccatgcactcaga |
18168836 |
T |
 |
| Q |
114 |
agagaaatcattgtcgtgtccaatgtttgtgtctgtgcttcgtagcgatgattcaagtaatgaagctaatgggagaaagagaaatgaagaaactaaattt |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18168835 |
agagaaatcattgtcgtgtccaatgtctgtgtctgtgcttcgtagcgatgattcaagtaatgaagctaatgggagaaagagaaatgaagaaactaaattt |
18168736 |
T |
 |
| Q |
214 |
gatggtagctatgt |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18168735 |
gatggtagctatgt |
18168722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University