View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12684_high_10 (Length: 242)
Name: NF12684_high_10
Description: NF12684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12684_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 52464535 - 52464315
Alignment:
| Q |
1 |
cggatgatgcaaaagctgatgattttataaacatgtttaagaagcaattgaggttgcagaggcttaattcttttatccgttccaaaaacagcatttgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52464535 |
cggatgatgcaaaagctgatgattttataaacatgtttaagaagcaattgaggttgcagaggcttaattcttttatccgttccaaaaacagcatttgatc |
52464436 |
T |
|
| Q |
101 |
gatgatgataacacagacctacacttccctttgaatagtctagatgaaaagaaaatactccatttcataaagaaaaattactt-aattcatgttgagttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
52464435 |
gatgatgataacacagacctacacttccctttgaatagtctagatgaaaagaaaatactccattacataaagaaaaattacttgaattcatgttgagttt |
52464336 |
T |
|
| Q |
200 |
gattaaattatgagtctgtag |
220 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
52464335 |
gattaaattatgactctgtag |
52464315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 5 - 90
Target Start/End: Complemental strand, 52483689 - 52483604
Alignment:
| Q |
5 |
tgatgcaaaagctgatgattttataaacatgtttaagaagcaattgaggttgcagaggcttaattcttttatccgttccaaaaaca |
90 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||| | |||||||||||||| |||||||||| |||| || ||||| |
|
|
| T |
52483689 |
tgatgcaaaagctgatgatttcataaacaggtttaagaagcaactccggttgcagaggcttgattcttttatgcgttacagaaaca |
52483604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 17236307 - 17236373
Alignment:
| Q |
5 |
tgatgcaaaagctgatgattttataaacatgtttaagaagcaattgaggttgcagaggcttaattct |
71 |
Q |
| |
|
||||||||| ||||||||||||||||| | ||||||| ||||| | |||||| | |||||| ||||| |
|
|
| T |
17236307 |
tgatgcaaaggctgatgattttataaagaggtttaagcagcaacttaggttggaaaggcttgattct |
17236373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University