View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12684_high_13 (Length: 203)

Name: NF12684_high_13
Description: NF12684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12684_high_13
NF12684_high_13
[»] chr4 (1 HSPs)
chr4 (16-191)||(27878284-27878459)
[»] chr8 (1 HSPs)
chr8 (106-169)||(31870186-31870249)


Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 27878459 - 27878284
Alignment:
16 tattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27878459 tattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggt 27878360  T
116 gtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagaggttgcaacctggttcttctca 191  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27878359 gcggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagaggttgcaacctggttcttctca 27878284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 31870249 - 31870186
Alignment:
106 attttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaaga 169  Q
    |||||||||||||| ||||||||||||||||| |||||||||||| ||||  | ||||||||||    
31870249 attttgtggtgtggggatgttactgttgataggttgaaatggggtaatgagattatgaagaaga 31870186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University