View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12684_high_13 (Length: 203)
Name: NF12684_high_13
Description: NF12684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12684_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 27878459 - 27878284
Alignment:
| Q |
16 |
tattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878459 |
tattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggt |
27878360 |
T |
 |
| Q |
116 |
gtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagaggttgcaacctggttcttctca |
191 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878359 |
gcggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagaggttgcaacctggttcttctca |
27878284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 31870249 - 31870186
Alignment:
| Q |
106 |
attttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaaga |
169 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |||| | |||||||||| |
|
|
| T |
31870249 |
attttgtggtgtggggatgttactgttgataggttgaaatggggtaatgagattatgaagaaga |
31870186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University